Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 32302665 32307948 enh5399

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 32305497 rs143006163 A AGATAATGTAGTTACACTATTGGCT 5628844
chr2 32305497 rs70938318 A AGATAATGTAGTTACACTATTGGCT 5628845

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results