Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 32777025 32781175 enh112650

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 32777870 rs572311208 ATAAATAGTAGCCACTTAAAAAAT A 5629800

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results