Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 37200526 37205296 enh65253

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 37202068 rs372561101 A ATGACTAAGTCAATAGCAATTAGCATAT 5649847
chr2 37202068 rs576513383 A T 5649848
chr2 37202072 rs537673696 C T 5649849

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results