EnhancerDB
  1. Home
  2. TFBS
  3. MAFF[chr2:38869916-38869934]
Chromosome characteristics of MAFF[chr2:38869916-38869934]
Back to top
Enhancers possibly regulated by MAFF[chr2:38869916-38869934]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 38868945 38877495 enh48251
Bone Marrow (K562) Cervix (HeLa-S3) Thymus Blood (OCI-LY7) Peripheral Blood (MM.1S) Blood (T-cell)
SNP sites on MAFF[chr2:38869916-38869934]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 38869918 rs185859900 T C 5663890
chr2 38869923 rs562489610 TGCTGATTGGTCCATTTTACAGAGA T 5663891
Genes possibly regulated by MAFF[chr2:38869916-38869934]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MAFF[chr2:38869916-38869934]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results