Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 67520665 67524815 enh81701

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 67523637 rs17033407 C A 5813994
chr2 67523639 rs530971974 GATGTGTTATGTTGTTTGGC G 5813995

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results