Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 69157065 69161215 enh18630

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 69158486 rs6146804 AAAGAAAAGAGATTTAATTGACTCACAGTTCT A 5825467
chr2 69158486 rs869130258 AAAGAAAAGAGATTTAATTGACTCACAGTTCT A 5825468

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results