Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 75546127 75550253 enh44820

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 75548270 rs371666459 G GAGCTAATTAGTGTTCCCACT 5857274

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results