Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 75748185 75757555 enh81723

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 75751350 rs6146811 GCTTTATTAGCTGAGTATAT G 5858158
chr2 75751350 rs66854530 GCTTTATTAGCTGAGTATAT G 5858159

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results