Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 95676845 95685015 enh18724

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 95683287 rs537610421 AGCATCACTATTGTGTAGACAAGGAAACCCAG A 5897297

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results