Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 100284542 100288692 enh65297

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 100286688 rs575055698 CAGATAGGAGTGTTCAAAAGCATG C 5909561

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results