Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 101415889 101420857 enh44838

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 101418999 rs373104581 GGCACGTACCTGTATTCCCAGCTGCTTGGGA G 5915354
chr2 101418999 rs540533921 GGCACGTACCTGTATTCCCAGCTGCTTGGGA G 5915355

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results