Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 101982965 101991095 enh53209

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 101988481 rs527555612 A AGGTCAGGTTGGGCAGGAGCTTGAAGGCCG 5919555
chr2 101988481 rs74659462 A G 5919556

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results