Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 118758892 118763276 enh60848

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 118759170 rs184472589 C G 5978648
chr2 118759171 rs551223909 T TAACACCTCGCCTCAGTCTTCCTCC 5978649
chr2 118759171 rs56711078 T TAACACCTCGCCTCAGTCTTCCTCC 5978650

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results