Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 119634265 119642475 enh104730

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 119641569 rs548155375 ATGATTGGTCCATTTTACAGAGTGC A 5982955
chr2 119641573 rs13393265 T C,G 5982956

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results