Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 119760305 119766595 enh81789

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 119763862 rs573053126 C CACATTGGGCCCATTGGCCCCA 5983412

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results