Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 121458938 121475818 enh33605

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 121465980 rs181323959 G C 5993614
chr2 121465980 rs573743949 G GTGGCTCACACCTGTAATCCTAGCAC 5993615

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results