EnhancerDB
  1. Home
  2. TFBS
  3. SNAI2[chr2:122371839-122371848]
Chromosome characteristics of SNAI2[chr2:122371839-122371848]
Back to top
Enhancers possibly regulated by SNAI2[chr2:122371839-122371848]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 122366005 122371855 enh91299
Bone Marrow (K562)
SNP sites on SNAI2[chr2:122371839-122371848]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 122371841 rs536941104 GCAGGTGGATGACCTGAGGT G 6000539
chr2 122371846 rs191595163 T C 6000540
Genes possibly regulated by SNAI2[chr2:122371839-122371848]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SNAI2[chr2:122371839-122371848]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results