Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 186498885 186505795 enh53463

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 186504627 rs376404701 GTAACATTATAACTAAGTAAAGAGAAGAGT G 6240129

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results