Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 202778245 202786215 enh6111

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 202785885 rs146956483 CCCAGACCCCTGGAGGGAGCCTGGCA C 6295871

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results