| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr2 | 216878525 | 216884539 | enh19210 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr2 | 216879853 | rs568981730 | C | CGCGCGTGCGTGTGCGCGCATGTGTGT | 6351036 | |
| chr2 | 216879858 | rs560017523 | G | A | 6351037 | |
| chr2 | 216879863 | rs78804635 | T | G | 6351038 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|