EnhancerDB
  1. Home
  2. TFBS
  3. NRF1[chr2:216879852-216879863]
Chromosome characteristics of NRF1[chr2:216879852-216879863]
Back to top
Enhancers possibly regulated by NRF1[chr2:216879852-216879863]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 216878525 216884539 enh19210
Brain (SK-N-SH) Brain (SK-N-MC) Prostate (RWPE1) Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Placenta Peripheral Blood (MM.1S) Muscle (Myotube) Thymus
SNP sites on NRF1[chr2:216879852-216879863]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 216879853 rs568981730 C CGCGCGTGCGTGTGCGCGCATGTGTGT 6351036
chr2 216879858 rs560017523 G A 6351037
chr2 216879863 rs78804635 T G 6351038
Genes possibly regulated by NRF1[chr2:216879852-216879863]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NRF1[chr2:216879852-216879863]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results