Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 216972825 216980515 enh6149

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 216973869 rs138387504 GTGCGCATGCTCGGCGGGAATC G 6351479
chr2 216973869 rs397897622 GTGCGCATGCTCGGCGGGAATC G 6351480
chr2 216973869 rs41296884 GTGCGCATGCTCGGCGGGAATC G 6351481

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results