Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 217587029 217592699 enh62910

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 217592035 rs112735095 AATTTTTATTATGATCAGATATTGGGAAGATT A 6355641

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results