Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 228602125 228606275 enh53603

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 228605904 rs58156278 CGCAGTGAGCTGAGATGGCGCCATT C 6417492
chr2 228605904 rs71846463 CGCAGTGAGCTGAGATGGCGCCATT C 6417493

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results