| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr2 | 231120525 | 231124675 | enh94434 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr2 | 231124485 | rs144574839 | TCATATATATATATATATATATATATAC | T | 6427870 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|