Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 231748605 231752755 enh104941

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 231749902 rs548671889 GTATTTTCTTATATCTATGC G 6431680

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results