EnhancerDB
  1. Home
  2. TFBS
  3. PLAG1[chr2:231851857-231851871]
Chromosome characteristics of PLAG1[chr2:231851857-231851871]
Back to top
Enhancers possibly regulated by PLAG1[chr2:231851857-231851871]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 231832125 231854193 enh6196
Blood (T-cell) Astrocyte Bone (Osteoblast) Blood (GM12878) Blood (Karpas-422) Pancreas (Panc1) Muscle (Myotube) Thymus
SNP sites on PLAG1[chr2:231851857-231851871]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 231851859 rs536674565 AGGCGCAGGGGGCTGAACCCTCGGTTCCAGCCCCGATAACTCATCC A 6432683
Genes possibly regulated by PLAG1[chr2:231851857-231851871]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PLAG1[chr2:231851857-231851871]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results