Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 232147945 232152095 enh53611

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 232150599 rs150458441 CATTATATTCTCTTTGCATGT C 6434059

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results