- 
                Home
            
- TFBS
- YY1[chr2:232150598-232150602]
 
    
    
        
            
                
                    
                        
                            
                                | Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More | 
                    
                    
                        
                        
                            
                                
                                | chr2 | 232147945 | 232152095 | enh53611 | 
                                        
                                        
                                     |  | 
                        
                    
                
             
         
     
 
    
    
        
            
                
                    
                        
                            
                                | Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More | 
                    
                    
                        
                            
                                
                                    | chr2 | 232150599 | rs150458441 | CATTATATTCTCTTTGCATGT | C | 6434059 |  | 
                        
                    
                
             
         
     
 
    
    
        
            
                
                
                
                
                    
                        
                            Blank TSI value indicates lack of sufficient expression for calculation
                            
                                
                                    
                                        | Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More | 
                            
                            
                                
                            
                        
                     
                 
                
                
                
             
         
     
 
    
    
        
            
                
                
                
                
                    
                        
                            Blank TSI value indicates lack of sufficient expression for calculation
                            
                                
                                    
                                        | Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |