EnhancerDB
  1. Home
  2. TFBS
  3. OLIG3[chr2:233288542-233288552]
Chromosome characteristics of OLIG3[chr2:233288542-233288552]
Back to top
Enhancers possibly regulated by OLIG3[chr2:233288542-233288552]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 233281685 233290815 enh19327
Placenta
SNP sites on OLIG3[chr2:233288542-233288552]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 233288542 rs375327937 CTCCATATGCTGAACGCCGGT C 6441330
chr2 233288542 rs561195985 CTCCATATGCTGAACGCCGGT C 6441331
chr2 233288552 rs13016319 T A 6441332
Genes possibly regulated by OLIG3[chr2:233288542-233288552]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by OLIG3[chr2:233288542-233288552]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results