-
Home
- TFBS
- OLIG3[chr2:233288542-233288552]
| Chrom |
Start |
End |
Enhancer ID |
Tissues that enhancer appears |
More |
| chr2 |
233281685 |
233290815 |
enh19327 |
|
|
| Chrom |
Position |
dbSNP ID |
Reference Allele |
Alternative Allele |
id |
More |
|
chr2
|
233288542
|
rs375327937
|
CTCCATATGCTGAACGCCGGT
|
C
|
6441330
|
|
|
chr2
|
233288542
|
rs561195985
|
CTCCATATGCTGAACGCCGGT
|
C
|
6441331
|
|
|
chr2
|
233288552
|
rs13016319
|
T
|
A
|
6441332
|
|
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
Strand |
Gene Name |
Ensembl ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
strand |
miRNA Name |
miRBase ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |