Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr2 | 237503965 | 237534871 | enh19376 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr2 | 237521329 | rs543263929 | CCTCT | C | 6471206 | |
chr2 | 237521337 | rs563451798 | TGCTACCTTTTTGAGTCTTTATTCCCCTGAGGGTAAGTGGAGGTTA | T | 6471207 | |
chr2 | 237521338 | rs556908815 | GC | G | 6471208 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|