Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 184139485 184149031 enh36210

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 184144291 rs544483673 ACTTAATAATGTATTGTAAAT A 7248298

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results