Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 238536317 238544295 enh34435

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 238542174 rs530913139 T TGAGAGGCGGTGTGGATGAGGGAAATCCAG 6481783
chr2 238542174 rs556518758 T G 6481784

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results