Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 238546188 238551355 enh65420

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 238547509 rs539242397 AATGCAGGTAGACTGGACTGATCGATGGACTG A 6481822

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results