Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 239192270 239196910 enh90053

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 239194317 rs558168582 ACCAGAGGCAGGACAGTGCCAGCCCC A 6485716

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr2 239152679 239198743 - PER2 ENSG00000132326.7 239198743 0.63 1.0 4426 3304


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results