Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 240513845 240517995 enh19415

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 240514629 rs545152793 GCATGGATGGGCACACAGGGC G 6496159
chr2 240514629 rs71043197 GCATGGATGGGCACACAGGGC G 6496160

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results