| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr2 | 240513845 | 240517995 | enh19415 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr2 | 240515633 | rs145583869 | G | GCACACAGCAGCCATGGATGAC,GCACACAGCAGCCATGGATGAG | 6496179 | |
| chr2 | 240515633 | rs71043198 | G | GCACACAGCAGCCATGGATGAC | 6496180 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|