Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 241224183 241229076 enh65430

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 241228719 rs533947751 A G 6499584
chr2 241228719 rs549807404 A ATTCCCTCCCGAGCAGGCCCAGCG 6499585

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results