Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 241774028 241778598 enh45049

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 241776351 rs373246610 CGGACCAGGACCAGCTGCTCCTGG C 6502297
chr2 241776351 rs556555509 CGGACCAGGACCAGCTGCTCCTGG C 6502298

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results