Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 242046900 242051148 enh87180

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 242048061 rs527490655 CCACGGGAGCTGCAGGCCACTTCAGAACAGGGT C 6503379

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results