Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 242084445 242088595 enh6229

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 242088377 rs145100336 GGCGGCGCGCGCCCCCGACCCC G 6503614

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr2 242045514 242089679 - PASK ENSG00000115687.9 242089679 0.92 1.0 1296 3337
chr2 242088991 242123067 + PPP1R7 ENSG00000115685.10 242088991 0.71 0.99 608 3338


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results