| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr12 | 62650628 | 62651393 | vista13734 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr12 | 62650947 | rs531475210 | G | GTGTGTATATGTATATATACACAA | 2679000 | |
| chr12 | 62650951 | rs373610382 | G | GTATA,GTATATGTATATATACACAA | 2679001 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr12 | 62654119 | 62811211 | + | USP15 | ENSG00000135655.9 | 62654119 | 0.74 | 0.97 | 3152 | 12279 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|