Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 62650628 62651393 vista13734

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 62650951 rs373610382 G GTATA,GTATATGTATATATACACAA 2679001

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 62654119 62811211 + USP15 ENSG00000135655.9 62654119 0.74 0.97 3150 12279


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results