Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 71770650 71771010 vista14006

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 71770910 rs112524054 C A,G 2726350
chr12 71770911 rs572900529 C A,G 2726351
chr12 71770915 rs146487543 AGACCAATCGGCTCTCTGTAAAATG A 2726352

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results