Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 107377522 107377900 vista14776

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 107377855 rs576024681 TTCACAGCTTTCATTATCCAG T 2880088

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 107371069 107380944 - MTERFD3 ENSG00000120832.5 107380944 0.69 0.97 3077 12489


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results