Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 185853205 185862692 enh21178

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 185859188 rs537435197 TTCACCATGTTAGCCAGGATGGTCTCGATC T 7258401

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results