Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 34823985 34828135 enh49485

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 34825590 rs191126682 G A 11002100
chr9 34825592 rs140719520 C CTGATGCAGGGTGTTCATGAGTCCT 11002101
chr9 34825592 rs373058156 C CTGATGCAGGGTGTTCATGAGTCCT 11002102

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results