Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 35632680 35643157 enh10722

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 35641336 rs536629899 A AACAAGGAGGTTAAAGATACAGGG 11004349
chr9 35641336 rs61206700 A AACAAGGAGGTTAAAGATACAGGG 11004350

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results