Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 36205105 36209255 enh78697

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 36205265 rs569390261 TCCACAGGACTCCACAGTCCCAGTC T 11007037

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results