| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr9 | 37553863 | 37558217 | enh46735 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr9 | 37555054 | rs146811924 | TTTTGTTTGTTTTTTGCAGGGTCACAC | T | 11015310 | |
| chr9 | 37555054 | rs371283660 | TTTTGTTTGTTTTTTGCAGGGTCACAC | T | 11015311 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|