Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 37553863 37558217 enh46735

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 37555054 rs146811924 TTTTGTTTGTTTTTTGCAGGGTCACAC T 11015310
chr9 37555054 rs371283660 TTTTGTTTGTTTTTTGCAGGGTCACAC T 11015311

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results