Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 38158685 38162835 enh94769

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 38162331 rs568385605 G GGGAAGATAACTTCATGGTAA 11019309

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results